Eyeless mutation gene located within the second intron of Drosophila melanogaster
Justin Lazarus
Genetic 300

Abstract
The following experiment was conduct over a several week time span to determine and identify the mutation that is causing the eyeless mutation within the Drosophila melanogaster fruit flies. The experiment included genome sequencing and comparison between the Drosophila melanogaster wild type and the Drosophila melanogaster eyeless type. After combining the two different phenotypes. We determined that we were unable to visualize the mutation at a chromosomal level, as both wild-type and eyeless flies looked similar. The experiment involved electrophoresis and Polymerase Chain Reaction (PCR) through which we were able to isolate and amplify the needed DNA eyeless DNA. The difference between the wild-type Drosophila melanogaster and the eyeless Drosophila melanogaster is approximately only 500-nucleotide base pairs. As we see the eyeless phenotype is approximately 3000 base pairs in length while the wild-type phenotype is approximately 2500 nucleotides base pairs in length, a difference of about 500 base pairs. After completing nucleotide sequencing and comparing our data on the blast website, we determined that the eyeless mutation has being interest exons two and three, but more specifically the mutation itself was located within the second intron at base pairs 8264 to 9212.
Introduction
In the early 20th century scientists had already been acquainted with chromosomes, yet the correlation between genes and heredity was still unknown. Many scientists believed that genes were located on chromosomes, but lack that scientific evidence to prove this theory. Thomas H. Morgan an American biologist along with his student at Colombia University discovered a particular eye color mutation in the Drosophila melanogaster. (1) Morgan was able provide definitive proof for the chromosomal theory of inheritance. Morgan was able to establish that the gene responsible for the white mutation in the Drosophila melanogaster was inherited together with the X-Chromosome.(1) Although Morgan’s data proved to be of great importance, it was Morgan’s student C.B. Bridges who ultimately unraveled the deviation to Mendel’s laws that had explained through chromosomal movement. Bridges was the first biologist to report on polytene chromosomes in detail. In certain organisms, some tissue may become polyploidy during the tissue development. The occurrence of this polyploidization may be the result for the need of multiple copies each chromosome along with the traits they accompany (1). The procedure that results in polyploid cells is known as endomitosis, this process incorporates the duplication of chromosomes, followed next by the detachment of the sister chromatids. This eventually leads to the build up of additional chromosomes in the nucleus.(1) Occasionally the polyploidization may not occur with the sister chromosomes being separated. This would results in a bundle of strands that are aligned in parallel. These chromosomes are known as polytene. Drosophila larvae have a great example of polytene chromosomes within their salivary glands. Each of these chromosomes has undergone nine separate rotations of replication, causing the overall production of 500 copies of every cell. (1). These copies will then bind closely creating a large bundle of chromatin fibers. According to Snustad and Simmons a mutation is defined as both a change in the genetic material, and the process by which this change occurred. A mutant is therefore defined as an organism that exhibits a novel phenotype resulting from a mutation (1). It had be discovered that mutation on a chromosomal level can occur due to many different reason such as deletion, in which a large amount of DNA sequencing has been removed. The type of mutation we see within the experiment would be the addition of nucleotides into the sequence, resulting in frame shift mutation. A novel phenotype could be a result of the transposons being added into a gene and therefor causing a mutation.
Drosophila melanogaster was among the first organisms used for genetics analysis, and today it is one of the most widely used and genetically best known of all eukaryotic organisms (2).
Drosophila eyeless mutation, this mutation leads to decrease production of the eye protein, resulting in a phenotype exhibiting a reduction or absence of the eye. This phenotype is viewed as a mutation yet the knowledge to why the mutation occurs is still limited. Eyeless gene is located on the fourth chromosome and when mutated, appears to produce variability in the size of the eye (3).
We believe that there are three possible hypotheses for the follow experiment. Firstly, we believe that there is a mutation within the splicing mechanism. Second, we believe that there is a mutation occurring within the scaffolding proteins. Finally we hypothesize that a mutation has occurred on the enhancer or silencer proteins.
Methods
Drosophila Polytene Chromosomal Squash Prep.
Polytene Chromosome Isolation/Staining
The purpose of this lab is to determine if the mutations studied in previous exercises are visible at the chromosomal level? We accomplished this through dissecting out the salivary glands from third instar larva in order to isolate the polytene chromosomes. These were then strains with Acetic-Orcein. This helped label the heterochromatic regions. After the chromosomes had been stained, we viewed the wild type and eyeless mutant under microscope to determine whether there was any visible difference between the two, or any signs of possible mutation.
Protocol had been modified from: Kennison JA, Preparations and Analysis of Polytene Chromosomes.
Genomic DNA isolation
In order to determine the cause of the eyeless mutation, we need to be able to determine the eyeless allele found in the mutant flies. In order to do this DNA from both the wild type and the eyeless adults had to be removed.
The following steps we use the Wizard SV Genomic DNA Purification System.
III.B. Preparation of Mouse Tail and Tissue Lysates (alteration) Mouse-tails were not used in this experiment; alternatively we ground up 25-30 flies to provide for the needed Drosophila melanogaster DNA. The tubes were not left over night overnight (16-18 hours), but rather incubated at 550 C for one hour.
PCR of the eyeless gene
The purpose of this section was to isolate the eyeless alleles from the previously isolated genomic DNA. Using primers designed to specific portions of the eyeless gene, we will attempt to “PCR out” the region of the genome potentially containing the eyeless mutation. (PCR kit from Promega).
A Typical PCR Reaction Alterations ddH2O 29.75ul (34.5ul) 10X PCR Buffer- 5.0ul (used 5x buffer instead of 10x) MgCl2 (25mM)
 3.0ul dNTPs (10mM each) 1.0ul Primer 1 (10uM) (F) 2.5ul Primer 2 (10 uM) (R)
 2.5ul
DMSO (Optional) 5.0ul (DMSO is omitted) Taq 0.25 total 49ul (Add 1ul of DNA (1 ng final volume))

Cycle: 1. Hot Start | 94C | 2 min | 2. Denaturation | 94C | 1 min | 3. Annealing | 35C – 62C | 1 min | 4. Elongation | 72C | 3 min | 5. Final Elongation | 7oC | 5 min Indefinitely | 6. Hold | 4C | | | | | Steps 2-4: Repeat 35 times | | |

PCR Clean Up
The purpose of this section was to obtain DNA from the previous laboratory session and purify it. To ensure there is no harmful by product from the PCR reaction that could potentially interfere with the experiment. The PCR clean up reaction was performed to ensure the proper DNA sequence is obtained.
Agarose Gel Electrophoresis:
1. Make a 1% agarose solution
a. Weigh out 0.4 g agarose and add it to 40 ml of 1x TAE in small flask
b. Bring the solution to a boil in the microwave (roughly 30 seconds on high). c. Be sure that the agarose goes in to solution (no white “chunks”.
d. Add 1.0 μl of 10mg/ml ethidium bromide.
e. Allow the solution to cool for 30 second or until it is approximately 500C.
2. Place cold dams in the apparatus and pour the agarose into gel apparatus.

3. Insert the comb with appropriate number of teeth into the gel solution. 4. Let the gel solidify at room temperature. 5. Remove the dams from the gel box, and cover the gel with 1x TAE Buffer.
6. Load the samples when ready
“GeneClean”
Cut out the DNA band of interest from the gel using a coverslip. Be sure that the chunk of agarose is as small as possible.
Follow the Procedure in the UltraClean 15 DNA Purification Kit (or Comparable DNA Extraction Kit) protocol alteration were made at this step. The UltraClean 15 DNA Purification Kit was replaced with Wizard SV and PCR Clean-Up System. Also we skipped section B and instead of using 50ul in step 8 we only used 25ul
Data collected 1.052mg/without DNA and 1.087 mg showing a 35 mg difference =35ul
End-A Cloning
This section of the experiment focused on the cloning of the PCR fragments in order increase to a suitable concentration for sequencing. Cloning will allow us to manipulate the PCR fragments, prior to cloning, we must use Taq polymerase to re add the “End-A’s” as they are lost over time.
Readdition of End A’s to the PCR Fragment
Steps 1-3 remained the same as below
1. Please set up a PCR reaction with the following ingredients for each of your samples in a PCR tube.
1.0 ul of PCR Buffer

0.2 ul of dNTP’s
0.2 ul of Taq

8.6 ul of sample DNA (prior PCR product)
2. Place the reactions into the thermocycler set at the following parameters.
940C: 2 Minutes 680C: 30 minutes 40C: infinite time.
3. Remove the samples from the thermocycler following the 30-minute run.
Alteration occurred at this point during the End-A Cloning Reaction/Transformation protocol. We used the pGEM®-T and pGEM®-T Easy Vector Systems

- Protocol for Ligations Using the pGEM ®-T and pGEM®-T Easy Vectors and the 2X Rapid Ligation Buffer
Section IV changes:The amount of PCR product add was 3ul to keep the total of 10ul
Section V changed to protocol: Step eight required: Add 950μl room temperature SOC medium to the tubes containing cells transformed with ligation reactions and 900μl to the tube containing cells transformed with uncut plasmid. we only added 100ul not 950ul rest of the protocol remained the same.

Miniprep of Plasmid DNA
This section of the experiment was to isolate the plasmid vector from the bacterial host so that we can prepare the DNA for sequencing, this process is also known as Mini prep. We used be the Promega Wizard Miniprep Kit
Two alteration occurred during this protocol was when using the Restriction Enzyme Digest protocol. Firstly, in step two 0.1ul of ddh2o was added instead of 1 ul Not 1. Secondly, instep four incubation was not for an hour and a half as indicated in the protocol but rather only incubated for one hour.
DNA Sequencing
The following section of the experiment involved the sequencing the isolated plasmids in order to determine the sequence of the eyeless fragment. We used the Sequenasetm sequencing kit and the LiCOR gel apparatus.

DNA | 2.64ul | fwd Primer | 1.5ul | reverse Primer | 1.5ul | Reaction Buffer | 7.2ul | Polymerase | 1.0ul | water | 6.16ul | total | 20ul |
Given: 200fmol DNA:
Wild-type= 5500 base pairs
Eyeless= 6000 base pairs
=300ng/ul
* 660g/mol base pair
Equation to determine the amount of ul DNA need
660/mol bp x 109/1g x mol/ 1015fmol x 6000bp x 1ul/ 300ng x 200fmol
=2.64 ul DNA
Analysis of Sequencing Results
This section of the experiment will be analyzing the results of the sequencing reactions in order to determine the cause of the eyeless mutation.
We have the eyeless gene now located within the pGEM-T plasmid. We bind two separate primer to the to the sequence, moving in opposite direction. One primer would be located on the top strand while the second primer is located on the bottom strand both moving in the 5’ to 3’ direction.
We only expect to correctly sequences approximately 800 base pairs. We where given two eyeless sequences along with one wild-type sequence.
The Sp6 primer as well as the T7 primer would act each of these sequences on. What analyzing the pGEM-TEZ we found that T7 also has a promoter region known as T7, which it recognizes, and starts priming from 5’ to 3’. T7 works on the top strand. While Sp6 doesn’t have a promoter site is does prime 5’ to 3’ on the bottom strand. These are known as the forward and reverse primers.
Steps:
Eyeless 1 Sp6.
Trim down the sequence to about 800 base pairs, we then highlighted the characters that followed the 800 characters. At no point did we delete any of the character. The highlight characters merely suggest that they are not included. We only want to keep these 800 characters as more than this would create chaos and may skew that data towards alternative things located within the plasmid.
When determining the front-end sequence when looking at the pGEM-T plasmid, there is about 60 base pairs sequenced prior to the insert these sequences will be seen as vector and not insert. This sequence must therefore be trimmed as well. When analyzing Sp6 you have to look at the sequence but in the opposite direction as Sp6 is associated with the bottom strand. We started off looking for GAATT then CACTA, next GTGATT all of these sites were located in the vector and needs to be trimmed out.
Now that we have determined the sequence we needed we wanted to know do we have eyeless insert. We do this by using blast (Basic local alignment search tool), as it contains recording of all known sequences. We can use this to compare and contrast our sequence to other known sequences. After completing this with the other two sequences we can determine the approximate base pairs they align to.
Results
Polytene chromosomes

Figure 1. Drosophila Polytene Chromosomes that have been labeled with an unknown dye. Polytene chromosome differs greatly in size compare to that of the mitotic chromosomes. Top left corner illustrates the comparative size of normal mitotic chromosomes to the extreme size of the Polytene Chromosomes

Figure 1. Drosophila Polytene Chromosomes that have been labeled with an unknown dye. Polytene chromosome differs greatly in size compare to that of the mitotic chromosomes. Top left corner illustrates the comparative size of normal mitotic chromosomes to the extreme size of the Polytene Chromosomes

PCR gel of WT and eyeless

Figure 2: PCR gel of WT and eyeless.

This figure represents the difference in base pair sizes of the wild-type and the eyeless genes. Wild-type exhibits 2500 base pairs while eyeless mutation exhibits 3000 base pairs, this is the representation of nucleotide insertion occur. Wild-type is shown on the far right hand right of the figure while eyeless is represent to its immediate left. The 1kb DNA ladder in the far left lane
Figure 2: PCR gel of WT and eyeless.

This figure represents the difference in base pair sizes of the wild-type and the eyeless genes. Wild-type exhibits 2500 base pairs while eyeless mutation exhibits 3000 base pairs, this is the representation of nucleotide insertion occur. Wild-type is shown on the far right hand right of the figure while eyeless is represent to its immediate left. The 1kb DNA ladder in the far left lane

Introns and exon containing the eyeless mutation Exon 1 | | | Exon 2 | 8264 to 9212 | | Exon 3 | | Exon 4 | | Exon 5 | | Exon 6 | |
Figure 3. Exon and intron containing eyeless mutation within the wild type sequence.
The figure above explains that when searching for the eyeless Sp6 aligns to the location to which the eyeless mutation is located. this showed that the eyeless mutation occurs with intron 2.
Figure 3. Exon and intron containing eyeless mutation within the wild type sequence.
The figure above explains that when searching for the eyeless Sp6 aligns to the location to which the eyeless mutation is located. this showed that the eyeless mutation occurs with intron 2.

Seye1-Sp6 GGSSMTGMTCAACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTTGGTCAGCGGGAACATTGATAGAGCGCCTGCCGTCTTTAGAAGACATGGCTCACAAGGGTAAGTGAATTTTTTAAATTTCTTGATTGGCATCATCGTCTTTATCCGACCCTCTTATAAATATATATGAGTCTTAGCCAACACATATGTTAATGCTGCCCATGGGCAGTTGATCCGGTCCTACTAGGCGAGTGCAGTTTCGTTCGGCTGTTGGTCTCTTTTGGCGCAGTTTACCAATAGAACTTCTGAACTGAATCGTTTGCGAACTCTTCTCTCAAACTCAAACTCCCGAGAGTAAGACGGCTTTATACTCCGTATAAATTGTCCAAATCAAAGATATTCAAATCTTCGCCGTGACTCTTATAATTCGAAAAACCTATATTTGTATTATACCCGTAGCTTGTTGCTAATTTGTATTTAAAGTAGTTAGTGGAAGGAAGAGTTCCCGGCTAGTCGATTTTCCGATGACCGTTGGCATGTCTGTCCGTCAGTATTGACGTCGAGACCTTTGGAAGCGAAATAAGTAGGAATTATGCAGATTCCAGTAATGCATACGCAGCTTAATTTTATATTAAACCATTGTCACTCACTCACATTGTAAATTACAACGCAAAGGCGTTTAATGATCAATGGCGTTCCTACGGGCGTATCTCATGCTATCCCGCGCGTATATGATTATTGAGTACTTCATACTAGCTGACTCTTTCGTTTTATACAAATTTGTATACTCGTTACTCATAGATTAAAGGGTTATTAGATTTTTTTAAATTTAAAGTATATATATTCTTGATCATGGTCAATCGGTCAATCTAGCCATGTCCGTCTAGCCATGTCCGTCTGCATGGACGTCGAGTTCTTAGGAACTATAAGAGCCAAAAGATTGCAATTTCTCGTTCACACATGCAGCCCATTTACGGGTATTGATAGTCAATAAAACCGGACTATAGCTCTCTTTCTCCTGTTTTTAGCTCAATAACGCTAACTGAAAAAGAATAAGCGCCTCCTTCTAAAGCCCATAATCGCCAGTAGTCTATGTATATATCGTCATACTGGAACTTTTAAACTAGCTCTACGTATAGCTAGGTCAAGTGAATTTCTAGGTGAAATTCCCT

Seye1-Sp6 GGSSMTGMTCAACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTTGGTCAGCGGGAACATTGATAGAGCGCCTGCCGTCTTTAGAAGACATGGCTCACAAGGGTAAGTGAATTTTTTAAATTTCTTGATTGGCATCATCGTCTTTATCCGACCCTCTTATAAATATATATGAGTCTTAGCCAACACATATGTTAATGCTGCCCATGGGCAGTTGATCCGGTCCTACTAGGCGAGTGCAGTTTCGTTCGGCTGTTGGTCTCTTTTGGCGCAGTTTACCAATAGAACTTCTGAACTGAATCGTTTGCGAACTCTTCTCTCAAACTCAAACTCCCGAGAGTAAGACGGCTTTATACTCCGTATAAATTGTCCAAATCAAAGATATTCAAATCTTCGCCGTGACTCTTATAATTCGAAAAACCTATATTTGTATTATACCCGTAGCTTGTTGCTAATTTGTATTTAAAGTAGTTAGTGGAAGGAAGAGTTCCCGGCTAGTCGATTTTCCGATGACCGTTGGCATGTCTGTCCGTCAGTATTGACGTCGAGACCTTTGGAAGCGAAATAAGTAGGAATTATGCAGATTCCAGTAATGCATACGCAGCTTAATTTTATATTAAACCATTGTCACTCACTCACATTGTAAATTACAACGCAAAGGCGTTTAATGATCAATGGCGTTCCTACGGGCGTATCTCATGCTATCCCGCGCGTATATGATTATTGAGTACTTCATACTAGCTGACTCTTTCGTTTTATACAAATTTGTATACTCGTTACTCATAGATTAAAGGGTTATTAGATTTTTTTAAATTTAAAGTATATATATTCTTGATCATGGTCAATCGGTCAATCTAGCCATGTCCGTCTAGCCATGTCCGTCTGCATGGACGTCGAGTTCTTAGGAACTATAAGAGCCAAAAGATTGCAATTTCTCGTTCACACATGCAGCCCATTTACGGGTATTGATAGTCAATAAAACCGGACTATAGCTCTCTTTCTCCTGTTTTTAGCTCAATAACGCTAACTGAAAAAGAATAAGCGCCTCCTTCTAAAGCCCATAATCGCCAGTAGTCTATGTATATATCGTCATACTGGAACTTTTAAACTAGCTCTACGTATAGCTAGGTCAAGTGAATTTCTAGGTGAAATTCCCT

Sequence 1: Seye1-Sp6. Sequence one represents the eyeless 1-Sp6 sequence.

The sequence shows three separate colors. The sequence that has been highlighted yellow and red are parts of the vector sequence and have been trimmed.
Sequence 1: Seye1-Sp6. Sequence one represents the eyeless 1-Sp6 sequence.

The sequence shows three separate colors. The sequence that has been highlighted yellow and red are parts of the vector sequence and have been trimmed.

Blast graphically representation of similarities to another known sequence the closer the sequence is to red to closer the similarity between the two sequences are.
Sequences producing significant alignments:

Chart 1: Seye1-Sp6 graphical depiction. The chart above shows the representation of the similarity of Seye1-Sp6 and other known sequences. The more red depicted show greater evidence that there is strong correlation to another known sequence
Chart 1: Seye1-Sp6 graphical depiction. The chart above shows the representation of the similarity of Seye1-Sp6 and other known sequences. The more red depicted show greater evidence that there is strong correlation to another known sequence

Table 1: This table represents sequences with similar or containing similar sequences as the Seye1-Sp6. Our main focus is that of the E value as this shows the level of identity, the closer the E value is to zero the closer the two sequences are to being same. As E value moves away from zero it begin to loose similarity.

It is important to acknowledge the fact that of the initial six sequences pulled up five of them spoke about the Drosophila melanogaster chromosome 4. This is vital information because we are sequencing the Eyeless –Sp6 we would expect to see chromosome 4 sequences evident, as the eyeless gene is located on chromosome 4.
Another important bullet would be the Drosophila melanogaster eyeless (ey), transcript variant D, mRNA this transcript showed 58/58(100%) identities. The Expect may not be close to zero but this is due to it being a transcript variant.
This is due to we added genomic DNA into the plasmid which contained everything as nothing has yet to be processed out yet. The only thing to be process out at this point would be the intron of the genomic DNA.
Seye2-Sp6

GGGMWRGCWCACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCACTAGTGATATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCGGGCCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAATACATTCAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTGCTCACCCAGAAACGCTGGTGAAGTAAAGATGCTGAAGATCAGTGGGTGCACGGAGTGGCTACATCGAACTGATCTCAACAGCGTTAGATCTGGARAAGTTTCGCCCGAGACGGTTTTCCATGATGACACTTGAAGTCTGCTATGTGGSGCGATATTWATTCG
Sequence 2: Seye2-Sp6. Sequence one represents the eyeless 2-Sp6 sequence. The sequence shows three separate colors. The sequence that has been highlighted yellow and red are parts of the vector sequence and have been trimmed.

Chart 2. Seye2-Sp6 graphical depiction. The chart above shows the representation of the similarity of Seye1-Sp6 and other known sequences. The more red depicted show greater evidence that there is strong correlation to another known sequence. The large amount red depicted here is due to the large occurrence of vector which exhibit similar multiple binding sites

Chart 2. Seye2-Sp6 graphical depiction. The chart above shows the representation of the similarity of Seye1-Sp6 and other known sequences. The more red depicted show greater evidence that there is strong correlation to another known sequence. The large amount red depicted here is due to the large occurrence of vector which exhibit similar multiple binding sites

When comparing the Wild-type and Eyeless 2 to eyeless we see there is a large amount of vector present, evidence didn’t show signs of pGEM-ETZ as there was such a large amount of vector present. The identity for all the vector would be zero or close to zero therefore line up, vectors also all have multiple cloning sites. Vectors do differ slightly from one to the next, but all vectors have multiple cloning site region that are pretty close to being the same.
When development of colonies occurred, we notice both white and blue colonies. The white colonies gave evidence that we had only obtained vector and not insert. This could have occurred when the vector and the eyeless were place together through the ligation process. If it only shows the vector is present then ligation didn’t occur and we weren’t able to get any one the eyeless. The gene didn’t stay linear to itself. The vector we have is B-galactosidase, it multiple cloning sites are located in the middle of B-galactosidase, so if B-galactosidase is present it cleaves the x-gal and the gel would turn blue.
White colonies don’t have a functional B-galactosidase, this is possible when you experience nuclease degradation and eliminate enough B-galactosidase so that it become non-function.
Most of the time blue-white colonies will show whether or not you have insert present.
Discussion.
At the start of this experiment we had three possible hypotheses for the follow experiment. Firstly, we believe that there is a mutation within the splicing mechanism. Second, we believe that there is a mutation occurring within the scaffolding proteins. Finally we hypothesize that a mutation has occurred on the enhancer or silencer proteins. As we have discover the hypothesis for mutation of the splicing could not be possible. If we were to encounter a mutation of the splicing mechanism it would alter everything we are seeing. Throughout the experiment there was no signs that mutation of splicing mechanism had occurred, as intron would be spliced out during the formation of the proteins.
When it came to the hypothesis that the scaffolding attachment regions SAR were mutated. If this were to occur it would have to occur on a large scale. If only one or a couple SAR’s were to be mutated, there would still be a metaphase chromosome. Apposing this is the possibility that the SAR’s underwent large mutation, this theory isn’t possible because if large amounts of SAR’s were mutated the phenotype would experience death. Therefore, this hypothesis doesn’t fit our phenotype we seeing.
Lastly, our hypothesis that a mutation that effected the silencer or enhancer. This hypothesis is not completely correct. When analyzing silencer, if we where to have 500 base pairs and have disrupted a silencer their would be an affect on gene translation but not in the way we would expect to see eyeless flies. If the silencer is effected then its ability to silence would be hindered, and transcription would increase. Therefore, the mutation of a silencer doesn’t fit our phenotype as it exhibits smaller eye.
The best possible fit for a hypothesis is the mutation of an enhancer. If there were an enhancer located in the intron, a 500 base pair insertion would disrupt its activity. This would cause the lowering of expression of the eye protein causing less eye protein to be present resulting in the phenotype of eyeless. This hypothesis does fit our expectations and results
We would test thing by performing a western blot test and a northern blot test. If we were to run the western blot test we would expect to see a decrease in expression of the protein of the eyeless compared to that of the wild type. If we were to run a northern blot test we would see an effect on the mRNA, the eyeless genes would experience a decrease in the mRNA. The use of RT-PCR (reverse transcriptase PCR) to isolate mRNA to reverse transcribe into DNA to have an idea how much mRNA is present. This would tell that there is less eyeless protein.
We would correlate this with the phenotype by variable expression as this could compare the eyeless flies that have variable expression and see if the levels of eyeless proteins or mRNA correlate with the phenotype.
Lastly, we could knock out the enhancer proteins and study the effect on the phenotype. We would take wild-type flies and mutate the region to which the enhancer encodes and see how they may differ, if we mutate the element being the enhancers we would expect to produce eyeless genes.

Reference page 1- Snustad, D. Peter., and Michael J. Simmons. Principles of Genetics. Hoboken, NJ: Wiley, 2012. Print. 2- Bruce , A., Bray, D., Hopkin, K., Johnson , A.D., Lewis, J., Raff , M., Roberts, K., & Walter, P. (2009). Essential Cell Biology (3rd edition ed.). 3- Arnini, C. 2012. Using Drosophila to Teach Genetics. Yale-New Haven Teachers Institute. Unit 96.05.01.