...Problem Set 1 Problem 1 Which project should the firm select? Why? Project B: Managers should try to maximize their stock’s intrinsic value while also bringing in revenue. The P/E ratio shows the dollar amount investors will pay for $1 of current earnings. Problem 2 If most investors expect the same cash flows from Companies A and B but are more confident that A’s cash flows will be closer to their expected value, which company should have the higher stock price? Explain. The primary goal of a corporation should be to maximize its owner’s value. If a manager is to maximize shareholder wealth, he/she must know how that wealth is determined. Fundamentally, shareholder wealth is the number of shares outstanding at times the market price per share. A stock’s price at any given time depends on the cash flows a “marginal” investor expects to receive after buying the stock. With that being said, Company A’s cash flow would increase the stock price and the risk would be minimal. Management’s goal should be to make decisions designed to maximize the stock’s price. Problem 3 The president of Southern Semiconductor Corporation (SSC) made this statement in the company’s annual report: “SSC’s primary goal is to increase the value of our common stock holders’ equity.” Later in the report, the following announcements were made: a. The company contributed $1.5 million to the symphony orchestra in Birmingham, Alabama, its headquarters city b. The company is spending $500 million...
Words: 628 - Pages: 3
...Problem Set 1 MGT-309 – Intro to Logistics Management November 23, 2014 Cosme Lucio Professor Jerry Bilbrey 2a. 2*8*44,000=704,000 .12*.75=.09 704,000/.09= 7,822,222.222222222 = 2796.823595120404 = 2797 2b. Inventory Carrying Costs = (2,797/2)*0.75*12% = $125.87 Order Costs = (44,000/2797) = 15.73 = 16, 16*$8(per order) = $128.00 Transportation Costs = 44,000 units *0.05 per unit = 2,200 (Q=2,797) = 125.87+128+2,200= 2453.87 Inventory Carrying Costs = (4,000/2)*.075*12% = $180 Order Costs = 44,000/4,000 = 11orders, 11orders*$8 per order = $88 Transportation Costs = 44,000*$0.04 per unit = $1760.00 (Q=4,000) = 180+88+1,760 = 2,028 2c. 4,000 CUPS = 11 orders, 33 days between orders 4a. Common days’ supply of chocolate chewies at DC: DS= [(42,000 – 7,000) + 18,500]/4,500 = 11.8888889 = 12(Rounded Up) 4b. Fair Share Allocation Logic: Cincinnati Allocation = (11.8888889 * 2,500) – 12,500 = 17,222.2222 Phoenix Allocation = (11.8888889 * 2,000) – 6,000 = 17,777.7778 6a. Yes. The demand never exceeded what was in stock and causing a stockout. 6b. SD = 1.811 6c. Yes. The frequency wasn’t out of bounds with mean, mode, median. 6d. SD = 1.095445 6e. SD of Combined Probabilities = 6 6g. f(k) = 0.061667 6h. k = 1.1, Required safety stock for the desired 99 percent is 6.42 with an average inventory of 36...
Words: 252 - Pages: 2
...Problem Set 5: 1) Advantages include the fact that polyclonal is cheaper, a mixture of different antibodies are made while monoclonal is only one specific antibody (this might depend on the experiment as some might prefer different antibodies), and large quantities are made. Disadvantages are that the affinities of the antibodies differ, a good amount of a specific antibody can’t be made alone unlike monoclonal, it is less reliable, and the same sample can’t be guaranteed each time unlike the monoclonal which can bring similar clones months later. 3) The GFP-HDAC3 overlaps the DAPI where the nucleus is. This shows that HDAC3 is a nuclear protein. However, some deletions show that the nucleus has gone smaller while others show that the nucleus has gone larger. The goal of this experiment was to find out how the different portions of the protein affected localization in the cell. The experiment does show that there was a significant effect. 4) Sense: 5’ aagccccatcgcctggcattg 3’ Linker Loop: 5’ uucaagaga 3’ Antisense: 5’ caatgccaggcgatggggctt 3’ Poly U: UUUUU The goal of the knockout would be to see if the removed proteins had any effect on the function of the cell. The siRNA should be 30%-50% GC content, 21 bp in length, have a AA on the 5’ end, a linker, around 75 bp ds of the gene, and have a poly U tail. These conditions are satisfied but the GC content is slightly high. 5) Fold increase in HDAC3 mRNA gene in control vs experiment = 1488/151= 9.85 fold increase...
Words: 364 - Pages: 2
...Problem set 1 Exercise 1 Giving €10 to a friend does not affect GDP because it is just an exchange of paper and there is no new production. Because she loses the money, she cannot go to the movies, so she cannot consume anything. That transaction does not affect France's 2014 GDP. Expenditure: consumption in services increase by €50 (only the service fee and not the loan). Income side: wages and profits should increase by €50. Value added: services value added should increase by €50. Expenditure: consumption in goods increases, but imports also increases. GDP stays the same. Income side: it does not increase in France but in the US. Value added: it increases in the US and not in France Winning the lotery is just a money transfer, it does not involve production, therefore it does not affect GDP. It is legalized so it should count in GDP and increase it, but because it is domestic production, it is not meant to be sold, so it does not affect GDP. Expenditure: consumption in non-durable goods increases by €105. Income side: wages plus profits shoul increase by €105. Value added: Restaurants value added should increase by €105. Exercise 4 (i) NominalGDP2012 = QuantityTV * PriceTV2012 + QuantityComputers * PriceComputers2012 = 100*500+20*1,000 NominalGDP2012= €70,000 NominalGDP2013 = QuantityTV * PriceTV2013 + QuantityComputers * PriceComputers2013 = 80*400+30*1,200 NominalGDP2013= €68,000 NominalGDP2014 = QuantityTV * PriceTV2014...
Words: 930 - Pages: 4
...Problem 1 a. What do you expect tuition and housing at top private schools to cost during Mary’s first year at college? PV=35,000; r=4%; N=18-5=13 FV=PV*(1+r)n =35,000*1+4%13 =58277.57 b. In nominal dollars, how much must be in the savings account on Mary’s 18th birthday after the last deposit has been made but before the first tuition and housing payment? PV18=58277.57; g=4%; r=10%*(1-τ)=10%*（1-30%）=7%; N=3 Pmt19=PV18*1+g=58277.57*1+4%=60608.67 The present value of year 18-21 at 18th year is: PV18-21=PV18+Pmt19r-g(1-(1+g1+r)N) =58277.57+60608.677%-4%1-1+4%1+7%3 =223488.53 c. What should be the amount of the first deposit to the savings account? FV=223488.53; r=10%*(1-τ)=10%*（1-30%）=7%; g=2%; N=18-5=13 Pmt1=FV1+rN-1+gNr-g =223488.531+7%13-1+2%137%-2% =10010.79 d. Alternatively, Mary’s parents could open a 529 account that allows college savings to grow tax-free. If they saved in this account rather than in a normal investment fund, and still earned the same pre-tax return, how much should be their first deposit? PV18=58277.57; g=4%; r=10%; N=3; Pmt19=PV18*1+g=58277.57*1+4%=60608.67 The present value of year 18-21 at 18th year is: PV18-21=PV18+Pmt19r-g(1-(1+g1+r)N) =58277.57+60608.6710%-4%1-1+4%1+10%3 =214721.71 FV=214721.71; r=10%; g=2%; N=18-5=13 Pmt1=FV1+rN-1+gNr-g =214721.711+10%13-1+2%1310%-2% =7957...
Words: 1347 - Pages: 6
...20. Juan’s Taco Company has restaurants in five college towns. Juan wants to expand into Austin and College Station and needs a bank loan to do this. Mr. Bryan, the banker, will finance construction if Juan can present an acceptable three-month financial plan for January through March. Following are actual and forecasted sales figures: Additional Actual Forecast Information November $120,000 January $190,000 April forecast $230,000 December 140,000 February 210,000 March 230,000 Of Juan’s sales, 30 percent are for cash and the remaining 70 percent are on credit. Of credit sales, 40 percent are paid in the month after sale and 60 percent are paid in the second month after the sale. Materials cost 20 percent of sales and are paid for in cash. Labor expense is 50 percent of sales and is also paid in the month of sales. Selling and administrative expense is 5 percent of sales and is also paid in the month of sales. Overhead expense is $12,000 in cash per month; depreciation expense is $25,000 per month. Taxes of $20,000 and dividends of $16,000 will be paid in March. Cash at the beginning of January is $70,000, and the minimum desired cash balance is $65,000. For January, February, and March, prepare a schedule of monthly cash receipts, monthly cash payments, and a complete monthly cash budget with borrowings and repayments. Juan’s Taco Company Cash Receipts Schedule November December January February March April Sales ...
Words: 771 - Pages: 4
...Week 3 Problem Set 1: Chapter 3: 62, 72 62) The Citizens Banking Company is studying the number of times the ATM located in a Lob laws Supermarket at the foot of Market Street is used per day. Following are the numbers of times the machine was used over each of the last 30 days. Determine the mean number of times the machine was used per day. 83 64 84 76 84 54 75 59 70 6163 80 84 73 68 52 65 90 52 7795 36 78 61 59 84 95 47 87 60 Answer: The ATM machine was used a mean number of times 70. 53. 72.) The weights (in pounds) of a sample of five boxes being sent by UPS are: 12, 6, 7, 3, and 10. 1. Compute the range. 3-12 2. Compute the mean deviation. 7.6 3. Compute the standard deviation. Chapter 5, 66 66) A survey of undergraduate students in the School of Business at Northern University Revealed the following regarding the gender and majors of the students: Major Gender Accounting Management Finance Total |Gender |Accounting |Major/management |Finance |Total | |Male |100 |150 |50 |300 | |Female |100 |50 |50 |200 | |Total |200 |200 |100 |500 | ...
Words: 478 - Pages: 2
...Networking Unit 1 Problem Set 1 Lesson 1 1. the general public in the United States will be able to purchase all of the Windows 7 editions in retail stores except... Starter, Home basic and Enterprise. 2. the core module that provides all of the Windows 7 capability that isn't language- or edition-specific is called... MinWin Module. 3. When you copy a file to a library, Windows Explorer writes the file to the folder designated as the … Save Location. 4. To use federated search, you must download or create XML files for specific sites called... Connectors. 5. The only operating system edition that you can upgrade in-place to Windows 7 Professional is... Windows 7 Ultimate. 6. Upgrading a computer running Windows 7 Starter to Windows 7 Ultimate using Windows Anytime Upgrade requires Blank megabytes of additional hard disk space. 0 7. to migrate a computer running Windows XP to Windows 7, you can use a utility called... Windows 7 Upgrade Advisor. 8. the new Windows 7 feature that renders all of the windows on the desktop transparent when you mouse over the right end of the taskbar is called... Aero Pack. 9. the Windows 7 Blank edition is only available in a 32-bit version. Starter 10. The maximum amount of system memory supported by Windows 7 Enterprise is... 192GB. Lesson 2 1. Windows Easy Transfer supports two types of migrations, called Blank and Blank. Wipe and Load & Side by Side 2. When a serious problem occurs with...
Words: 474 - Pages: 2
...MBA-FP6008: Assessment 1, Economics Problem Set 1 Dennis J. Johnson Capella University 08/12/2015 Problems A, B, and C Introduction This assessment will be an analysis of graphed data and changes in supply and demand for three economic problems. Problem A involves production possibilities for consumer and capital goods, problem B is an evaluation of changes in supply and demand equilibrium, and finally, problem C involves pricing with relevance to supply and demand. Successful completion of this assessment demonstrates proficiency in; applying theories, models, and practices of economic theory, analyzing solutions with support from relevant data, resources, references, and economic principles, analyzing graphed and circular flow diagram data, and analyzing changes in supply and demand in a competitive market. Problem A. Production Possibilities | Type of Production | Production Alternative A | Production Alternative B | Production Alternative C | Production Alternative D | Production Alternative E | Butter | 0 | 1 | 2 | 3 | 4 | Guns | 15 | 14 | 12 | 9 | 0 | Production Possibilities for Consumer Goods (Guns) and Capital Goods (Butter) 1. The specific assumptions that underlie the production possibilities curve are: that there are only two goods, consumer and capital, that they are produced in different proportions in the economy, the quantities of the resources do not change, production techniques are given and constant, and that resources are...
Words: 1353 - Pages: 6
...Unit 1 Problem Set 1: Scientific Method Applied Problem Sets Problem Set 1 1. A Null Hypothesis refers to a hypothesis that is going to be, or needs to be tested for validity. According to Wikipedia, a Null Hypothesis also refers to the testing of sets of data that appear to have no correlation together that need validation. This is critical in the scientific method because it constitutes whether or not theories that are formulated are correct, incorrect, or in need of adjustments/edits. When a researcher formulates a theory based on one set of data elements and then there is another set of data elements that may or may not refute the theory, a null hypothesis is formed for research and validation. The scientific method is all about trying to figure out the world we live in and how it works based on what we observe, though what we observe may or may not be all of what is involved thus pushing us to proving what we observe to further learn and explain the world around us. 2. Null: Exposure to mercury does not affect the thickness of bird eggshells. Alternative: Exposure to mercury does affect the thickness of bird eggshells. Null: Salt used on roads in winter does not affect the size of plants living by the roadside. Alternative: Salt used on roads in winter does affect the size of plants living by the roadside. Null: Oil covering gulls does not affect the gull's ability to fly. Alternative: Oil covering gulls does affect the gull's ability to fly. Null:...
Words: 316 - Pages: 2
...Fill in the blank Page 24 1. The general Public in the United States will be able to purchase all of the Windows 7 editions in retail stores except starter, home basic, and enterprise. 2. The core module that provides all of the Windows 7 capability that isn’t language- or edition specific is called minwin. 3. When you copy a file to a library, Windows Explorer writes the file to the folder designated as the save location. 4. To use federated search, you must download or create XML files for specific sites called search connectors. 5. The only operating system edition that you can upgrade in-place to Windows 7 Professional is windows vista business. 6. Upgrading a computer running Windows 7 Starter to Windows 7 Ultimate using Windows Anytime Upgrade requires 0 megabytes of additional hard disk space. 7. To migrate a computer running Windows XP to Windows 7, you can use a utility called user state migration tool. 8. The new Windows 7 feature that renders all of the windows on the desktop transparent when you mouse over the right end of the taskbar is called aero peek. 9. The Windows 7 Starter edition is only available in a 32-bit version. 10. The maximum amount of system memory supported by Windows 7 Enterprise is 192 GB (64bit). Fill in the blank page 61 1. side-by-side, wipe-and-load 2. Windows recovery environment 3. windows easy transfer, USMT 4. 72 hours of continuous operation 5. floppy disks 6. multilingual...
Words: 267 - Pages: 2
...Unit 1 Problem Set 1 Section 1-2 Ex. 26: A. Yes. B. Yes, because 92% of 73 is 67, while 72% of 83 is 59. This shows that even in a smaller total amount of surgeries, there are still a greater amounts of success. C. There is a difference between the two types of help. If it implies that there must be a difference as in an increase in both then it would have to be taken again. D. I would have to say make another study before anything concrete. If this is the only evidence then yes, it should. Section 1-3 Ex. 30: The sample is the 9% of the population (91). The population is the 1012. Yes, it is representative since it is just a random poll. Section 1-4 Ex. 18: He is asking the students to enter their height rather than a third party to measure them. He is also asking in inches which some students may only know their height in centimeters. Section 1-5 Ex. 8: Expirament. Section 1-5 Ex. 18: Stratified Sampling. Section 2-2 Ex. 12: Weight of Discarded Metal and Plastic(lbs) | Frequency of Metal | Frequency of Plastic | 0.00-0.99 | 5 | 14 | 1.00-1.99 | 26 | 20 | 2.00-2.99 | 15 | 21 | 3.00-3.99 | 12 | 4 | 4.00-4.99 | 4 | 2 | 5.00-5.99 | 0 | 1 | They appear to be different. Where the first metal frequency is outweighed it is then again in the second by a greater amount. Metal 1 = 4.95 while Plastic1= 13.86 Metal2 =25.74 while Plastic2= 39.8...
Words: 276 - Pages: 2
...Econ 301B Winter 2012 Problem Set 1 Due date: Monday, January 23 in class 1. Suppose the country of Utopia has a population of 1,000 and produces only three goods: T-shirts, cars and pineapples. Assume that Utopia does not trade with other countries. The production amounts and prices (in US Dollars) for 2009, 2010 and 2011 are given in the table below: Year 2009 2010 2011 Quantity of Tshirts 10,000 9,500 10,500 Price of Tshirts Quantity of cars Price of cars Quantity of pineapples Price of pineapples $10 $10.50 $11 75 85 90 $15,000 $16,000 $15,500 50,000 60,000 45,000 $4 $4.50 $5 a) Using 2009 as base year, calculate nominal and real GDP per capita for 2009, 2010 and 2011. b) Keeping 2009 as base year for prices, compute Utopia’s inflation rates for 2010 and 2011 using both the CPI and the GDP deflator. When calculating the CPI, assume that the representative consumer purchases in any given year 10 T -shirts, 1 car and 100 pineapples. c) Explain why the computed inflation rates are not the same when u sing the two different methods. 2. For this question assume that we are within the short -run goods market framework developed in Chapter 3 in Blanchard. Suppose that the economy is characterized by the following behavioral equations: Note that in this economy investment, I, depends positively on output, Y. This mirrors the fact that firms in the real world will increase their investment expenditure...
Words: 392 - Pages: 2
...Problem Set 1 1. MPL = 30 MPL/MPK = w/r MPK = 24 r = 15 30/24 = w/15 w = 18.75 2a. A = E > C = B > D 2b. A = C > B 3a. Q = 5KLL w = 8 r = 15 MPL/MPK = w/r = 8/15 3b. rK = (15)(10) = 150 wL = 150 8L = 150 L = 18.75 4a. Q = 2KLLL K = 2 Q = 2(2)LLL = 4LLL At L = 1, Q = 4 At L = 2, Q = 32 At L = 3, Q = 108 At L = 4, Q = 256 MPL for 4th worker = 256 - 108 = 148 4b. This production function exhibits increasing returns to scale. 5a. AVC = ATC since AFC = 0 Price = 2.50 MC = 1.20 5b. No, they are not at a long run equilibrium, producers are benefiting for a surplus and in a long run more firms will enter the industry bringing the surplus to 0, pricing will be at P = MC. 6. Rule of thumb pricing P = MR = MC MR = P + P (1/E) = MC P = MC/ ((1 + (1/E)) C = 125 + 25Q MC = dC/dQ = 25 P = 25/((1 +(1/-3)) = 37.5 7a. P = 1100 - 2Q C=Q Total Revenue = P x Q = (1100 -2Q) x Q = 1100Q – 2QQ Marginal Revenue = dTR/dQ = 1100 – 4Q Marginal Cost = dC/dQ = 1 MR = MC 1100 – 4Q = 1 Q = 274.75 P = 550.5 7b. MC=1 MR = 550.5 Markup = (P – MC)/P = 0.9982 = 99.82% 7c. Profit = Marginal...
Words: 255 - Pages: 2
...1. Refer to Problem 1.8 on page 59 of the Hubbard/O’Brien textbook. To answer questions a, b, and c, carefully study the graph and identify the points that are unattainable, efficient, and inefficient. Be sure to explain how you identified the points in each case. To answer question d, note that the graph shows the trade-off between producing capital goods (machines, tools, and factories) and producing consumption goods (food, clothing, and movies); which of these will add to an economy’s ability to produce in the future? a. Point E is currently unattainable because that point is beyond the line meaning that there are not enough resources to reach that point. b. Points B, C, and D are efficient because the points are on the line in the graph. c. Point A is inefficient because that point is below the line meaning all resources are not being used. d. Point D is likely to have the highest growth rate because there are more consumption goods being used at that point. 2. Refer to Problem 3.7 on page 62 of the Hubbard/O’Brien textbook. George represents households while BMW and McDonald’s represent firms. For each transaction, identify whether the transaction takes place in the factor market or the product market. • If the transaction takes place in the factor market, indicate whether households are supplying or demanding factors of production and whether firms are supplying or demanding factors of production. • If...
Words: 391 - Pages: 2
