...University of Phoenix Material What Is Life? Read each statement. Write a 100-word summary explaining how that media piece supports that statement and include reference citations. 1. Find a media piece—article, video, presentation, song, or other—related to the scientific method, creating hypotheses, or designing experiments. Include the link or reference citation for the piece and describe how it helped you better understand how the scientific method is used to create hypotheses and experiments. [pic] 2. Find a media piece—article, video, presentation, song, or other—that recognizes the fundamental concepts of chemistry in biology. Include the link or reference citation for the piece and describe how it helped you better understand how fundamental concepts of chemistry affect biology. [pic] 3. Find a media piece—article, video, presentation, song, or other—that describes the energy metabolism of cells. Include the link or reference citation for the piece and describe how it helped you better understand the energy metabolism of cells. [pic] 4. Find a media piece—article, video, presentation, song, or other—that compares structures and functions of different cell types. Include the link or reference citation for the piece and describe how it helped you better compare structures and functions of different cell types...
Words: 1397 - Pages: 6
...Biogenesis of the T1-S1 Linker of Voltage-Gated K+ Channels Running Title: The T1-S1 Linker of nascent Kv1.3 Key words: Protein folding, nascent peptides, potassium channel biogenesis, T1 domain, S1 transmembrane segment 1 Abstract In the model derived from the crystal structure of Kv1.2, a 6-transmembrane voltagegated potassium channel, the linker between a cytosolic tetramerization domain, T1, and the first transmembrane segment, S1, is projected radially outward from the channel’s central axis. This T1-S1 linker was modeled as two polyglycine helices to accommodate the residues between T1 and S1 [Long et al. (2005) Science 309, 897-903], however, the structure of this linker is not known. Here, we investigate whether a compact secondary structure of the T1-S1 linker exists at an early stage of Kv channel biogenesis. We have used a mass-tagging accessibility assay to report the biogenesis of secondary structure for three consecutive regions of Kv1.3, a highly homologous isoform of Kv1.2. The three regions include the T1-S1 linker and its two flanking regions, α5 of the T1 domain and S1. Both α5 and S1 manifest compact structures (helical) inside the ribosomal exit tunnel, whereas the T1-S1 linker does not. Moreover, the location of the peptide in the tunnel influences compaction. 2 Introduction Voltage-gated K+ (Kv) channels are critical to the normal functioning of excitable and non-excitable cells (1,2). Defects in their biophysical properties, biogenesis...
Words: 8360 - Pages: 34
...inflammation responsible for the destruction. Therapies have developed to target TNF-α bringing a substantial impact on patient care. The exact etiology remains unclear in this autoimmune progressive disorder, but much is being looked at in search of an autoantigen or another triggering agent. According to Robinson,2 the importance of early diagnosis and subsequent treatment of RA is becoming more accepted. He goes on to say that accurate triaging is needed of primary care physicians to accomplish this, along with the expedition of rheumatologist’s assessments. Patients will typically complain of swollen joints, which upon assessment and confirmation by a general practitioner (GP) would be seen as urgent along with a raised C-reactive protein....
Words: 4663 - Pages: 19
...Experiment 10. The effect of pepsin on egg white suspension (a) Label four test-tubes 1-4. (b) Into each tube place about 5 cm3 (20 mm in test-tube) egg white suspension. (c) To tubes 2,3 and 4 add three drops of dilute hydrochloric acid. (d) Using a graduated pipette or syringe place 1 cm3 1% pepsin solution in a clean test- tube and heat it over a small Bunsen flame until the liquid boils. Add the boiled pepsin to the egg-white suspension in tube 4. (e) Prepare a water bath in a 250 cm3 beaker or jar by mixing hot and cold water from the tap to attain a temperature of about 40 °C. Have the beaker about half full. (f) Using a graduated pipette or syringe, add 1 cm3 1% pepsin to tubes 1 and 3 only. (g) Place all four tubes in the water bath and copy the table below into your notebook. (h) After five or six minutes remove the four tubes from the water bath and replace them in the test-tube rack. Compare the appearance of the contents and fill in your table of results. |Tube |Contents |Results | |1 |Egg-white suspension & pepsin | | |2 |Egg-white suspension & HCl | | |3 |Egg-white suspension, pepsin & HCl ...
Words: 825 - Pages: 4
...Protein is found in every cell, muscle and tissue of our body and is also present in many of the foods that we eat daily. Protein is a major component of all muscles, tissues and organs and is vital for practically every process that occurs within the body such as metabolism, digestion and the transportation of nutrients and oxygen in the blood. The protein in our body is essentially the same as the protein in our food, except that it is structured differently. (Unknown author- (2001-2010) Protein - an introduction to protein in the diet) Based upon chemical composition, proteins are divided into two major classes: simple proteins; which are composed of only amino acids, and conjugated proteins; which are composed of amino acids along with additional organic and inorganic groupings, also known as prosthetic groups. (The Columbia Electronic Encyclopedia, 6th ed. Copyright © 2007, Columbia University Press) Amino acids are the building blocks of all proteins. Amino acids are chemical compounds containing carbon, hydrogen, oxygen and nitrogen, which combine together into different structures to form the various types of protein that the body needs. The body requires 20 different amino acids, 8 of which are referred to as essential amino acids, which cannot be synthesized by the human body. Non-essential amino acids can be synthesized by body but this does not mean they are less important because they are. The body is capable of producing enough protein to meet the demands for...
Words: 767 - Pages: 4
...brown rice, yogurt, whole wheat pasta, whole grain bread and legumes. ------------------------------------------------- Potassium and Sodium Potassium and sodium are electrolyte minerals that play critical roles in exercise, especially when it is intense and of a long duration. Excessive sweating cause’s potassium and sodium levels to become depleted in the body. Your body needs potassium and sodium for fluid balance, nerve signal transmission and muscle contractions. Include foods in your diet that contain both of these minerals. Raisins, salted nuts, peanut butter, apricots, oranges and raisins are examples. ------------------------------------------------- Iron Iron is a mineral that aids in the production of the oxygen-carrying proteins hemoglobin and myoglobin. A lack of iron in the diet will cause you to feel tired and weak, and your muscles...
Words: 554 - Pages: 3
...David Hrobochak Biology 1740 Kirstin Purcell Common Book Assignment 2 The reasons you can get more proteins from the genes are because each gene is individual, and each protein has a different function. Some proteins are responsible for structural support while others are responsible for defense against germs; others are involved in bodily movement. There are 4 levels of protein structure. The first is primary, which is the sequence of amino acids that make up protein. Different proteins will have different sequences of amino acids. Secondary structures are the coils or folds in the helix due to hydrogen bonding. Tertiary structures are just further folding of the polypeptide and quaternary structures are 2 or more polypeptide units folding together. The folding of all these amino acids causes the multiplication of proteins. I agree that nature plays a part of our development. Look at the scientific theory of evolution. Are we really descendents of apes? From a scientific perspective this is conceivable. The outbreak of Malaria is tolerated in most countries, but in Africa it is a widespread pandemic. This is an example of genetic variation. I believe 100 percent of us are genetic. We are created through genetic variation and the inheritance of variation. Natural selection is how we can cope with environmental changes. This is why certain individuals can deal with extreme temperatures better than others. The ability for each individual to go longer without water during times...
Words: 535 - Pages: 3
...Protein Engineering Programme: B.Tech (Biotech) 6th Semester Course code: BIT 317 (3 credits) Unit 1 – Introduction Winter 2012-13 Dr. Everette Jacob Remington N, Ph.D Associate Professor & Ramalingaswami Fellow Biomedical Sciences Division & Gene Therapy Laboratory School of Biosciences and Technology VIT University, Vellore - 632 014, TN 1 Course objective To make the student familiarize with the basics, concepts and application of protein engineering Expected course outcome Explain the principles involved in the maintenance of protein structure Analyze the given protein structure and predict the sites to be engineered for altering/introducing a specific property 2 Course Outline Unit 1 – Introduction (9 hrs) Unit 2 – Protein Sequences and Properties (9 hrs) Unit 3 – Conformation of Proteins (9 hrs) Unit 4 – Principles and Approach (9 hrs) Unit 5 – Probing Structure for Molecular Recognition (9 hrs) 3 Unit 1 Introduction (9 hrs) Amino acid structure and properties Detection of the size of proteins Covalent structures in proteins Overview of chemical and biosynthesis of proteins Topogenesis Post-translational covalent modification of polypeptide chains 4 Amino Acids Amino acids are molecules containing an amine group, a carboxylic acid group, and a side-chain that is specific to each amino acid The amino group is attached to the carbon atom immediately adjacent to the carboxylate...
Words: 3947 - Pages: 16
...element, which have differing numbers of neutrons. Atoms of a particular element by definition must contain the same number of protons but may have a distinct number of neutrons which differs from atom to atom, without changing the designation of the atom as a particular element. The number of nucleons (protons and neutrons) in the nucleus, known as the mass number, is not the same for two isotopes of any element. Components of nucleic acid 1). DNA = deoxyribonucleic acid - genetic material that stores information to synthesize proteins and to replicate new DNA. The genetic code is based on four nitrogen bases: adenine (A), thymine (T), guanine (G), cytosine (C). A bind with T and G binds with C.2). RNA = ribonucleic acid - helps in synthesizing proteins. There are three main types of RNA.a. mRNA - messenger RNA, copy of the DNA, sent out into the cytoplasm. Contains the genetic code for making proteins.b. rRNA - ribosomal RNA, building site for proteins. Reads the mRNA and allows the right tRNA to bring in the right amino acid.c. tRNA - transfer RNA, brings the right amino acid to the rRNA.3). ATP = adenosine triphophate, Adenosine is made from adenine and a 5 carbon sugar. It is the energy source for all living organisms cells.What is the function of carbohydrates? Carbohydrates provide the body with a source of fuel and energy that is required to carry out daily activities and exercise. Any extra energy is stored in the body until its needed. Our bodies need a constant supply...
Words: 1425 - Pages: 6
...Describe how inhibitors affect the rate of an enzyme-catalysed reaction Describe the advantages of using immobilised enzymes in industrial processes * Two types of inhibitors – Competitive and non-competitive * Both types of inhibitors reduce the rate of reaction * Competitive inhibitor is structurally similar and competes with substrate for active site of enzyme * This prevents substrate from binding to the active site * Fewer/ no enzyme-substrate complexes formed * If substrate concentration is increased in reduces the effect of the inhibitor. * Non-Competitive inhibitor binds away from the active site * This alters the overall shape of the enzyme, including active site * Substrate and inhibitor are not competing for the same active site * Therefore increasing substrate concentration will have no effect of rate of reaction * Enzymes tolerate wider range of conditions such as temperature/ph * Enzymes are easily reused thus reducing costs * Several enzymes can be used together * Product is not contaminated * Enzymes are easily added or removed Describe the functions and importance of mitosis to living organism using example where appropriate Describe how meiosis differs from mitosis and explain the significance of these differences * Mitosis results in daughter cells that are genetically identical * That have the same...
Words: 951 - Pages: 4
...specific antibody (this might depend on the experiment as some might prefer different antibodies), and large quantities are made. Disadvantages are that the affinities of the antibodies differ, a good amount of a specific antibody can’t be made alone unlike monoclonal, it is less reliable, and the same sample can’t be guaranteed each time unlike the monoclonal which can bring similar clones months later. 3) The GFP-HDAC3 overlaps the DAPI where the nucleus is. This shows that HDAC3 is a nuclear protein. However, some deletions show that the nucleus has gone smaller while others show that the nucleus has gone larger. The goal of this experiment was to find out how the different portions of the protein affected localization in the cell. The experiment does show that there was a significant effect. 4) Sense: 5’ aagccccatcgcctggcattg 3’ Linker Loop: 5’ uucaagaga 3’ Antisense: 5’ caatgccaggcgatggggctt 3’ Poly U: UUUUU The goal of the knockout would be to see if the removed proteins had any effect on the function of the cell. The siRNA should be 30%-50% GC content, 21 bp in length, have a AA on the 5’ end, a linker, around 75 bp ds of the gene, and have a poly U tail. These conditions are satisfied but the GC content is slightly high. 5) Fold increase in HDAC3 mRNA gene in control vs experiment = 1488/151= 9.85 fold increase. Fold increase in the internal Actin control = 1058/479= 2.21 fold increase. Real fold increase of HDAC3 = 9.85/2.21= 4.46. 6) The threshold cycles...
Words: 364 - Pages: 2
...Eukaryotic cells solved the problem of moving proteins and organelles from one part of the cell to another, faster than would occur by diffusion? And give a specific example to illustrate how a protein may be moved from part of the cell to another. The huge volume inside a eukaryotic cell is compartmentalized into a large number of bacterium-sized parts. Because eukaryotic cells are subdivided, the molecules required for specific chemical reactions are often located within a given compartment and do not need to diffuse long distances to be useful. Additionally, compartmentalization increases the efficiency of chemical reactions. First, the substrates required for particular reactions can be localized and maintained at high concentration within organelles. Second, groups of enzymes that work together can be clustered on internal membranes instead of floating free in the cytoplasm. Clustering these molecules increases the speed and efficiency of the reactions, because reactants have shorter distances over which to diffuse or be transported. ii. An example to illustrate how a protein may be moved from part of the cell to another. For example, in localization sequencing a protein might be sent to the nucleus or marked for secretion outside of the cell. Additionally, in the SH2 domain , a protein domain is present in many signaling proteins. For example, the SH2 binds a short amino acid sequence containing a phosphotyrosine, and moves a protein containing it to sites in the plasma...
Words: 1044 - Pages: 5
...the DNA sequence defines the amino acid sequence in the primary structure The structure of the dna is very important ,it has specifc order.if one gets moved or is incorrect it can cause mutation. Different 3 base pairs codes form different amino acids. The amino acids then are linked in the order that they appear in a section of DNA into protiens. The formation of the amino determines how the proteins folds and twists which controls the overall shape. The shape has to be precisely right or the protein will not function properly. If you have any Deformed proteins they can cause a person to be lactose intolerance, sickle cell animia and to have some allergies. 3. Identify the groups in an amino acid. 1.Amino group 2.R Group (Side chain) 3.Carboxyl group 4. Identify and describe the reaction shown in the diagram. A Water molecule is removed by condensation between the carboxyl. 5. Describe the role of the peptide backbone, variable side chains and the bonds holding the primary structure together. Polypeptides and proteins are chains of amino acids held together by peptide bonds. 6. Define the secondary structure. Secondary structures are polypeptide chains folded into one of two configurations: either an alpha helix, or a beta pleated sheet. 7. Identify the secondary structures from the diagrams below and label the diagrams. 8. Describe a hydrogen bond. A weak bond between...
Words: 278 - Pages: 2
...Formation of Cellulite Explained Cellulite is not restricted to fat people. Even lean people can suffer from it. Losing cellulite is more difficult than losing fat. Cellulite is the swelling of the fat cells, which then appear as bumps on the body, causing what is known as the 'dimpling effect', or the 'orange peel effect', because the cellulite affected area resembles an orange peel. In the following paragraphs we will find out the exact nature of cellulite and how it is formed. Once that is clear, it will be easier to understand how to get rid of it. Appearance of Cellulite on the Skin The skin is made up of many different layers, called 'dermis'. The fat cells that are under the skin are connected to the skin with the help of a layer called 'septa', which is fibrous in nature. This layer forms a wall between the fat cells and the skin. But when this layer beaks down, the fat cells which expand, do so directly against the skin, so that there is no layer between the two. Due to this the skin develops pits and valleys, and resembles an orange peel, or cottage cheese, or has a dimpled appearance. The appearance of cellulite is different in men and women, but the difference is not very significant. Causes of Cellulite The causes of cellulite in men and women differ. In women, the hormonal changes during menstruation, menopause, pregnancy, etc., which regulate the flow of blood, lymphatic drainage and fat, are mainly responsible for the formation of cellulite. Birth control...
Words: 354 - Pages: 2
...Protein Article Research Protein is an essential part of a healthy diet. It is made of different combinations of 20 different amino acids. Protein is found in every cell, tissue, and organ of the body. It is important to consume an adequate amount of protein because our bodies are constantly using the protein we digest to make more amino acids. Some amino acids cannot be produced by the body and it is essential that our diet contain them. There are different types of protein and they are labeled according to the amount and type of amino acids they contain. The first is known as a complete protein source. Complete protein sources contain all of the essential amino acids. They are also known as high quality proteins. The other is known as an incomplete protein source. This is a protein source that lacks one or more of the essential amino acids. Proteins can be consumed in conjunction in order to make up all of the essential amino acids. This is called complementary proteins. ("Center for Disease Control and Prevention", n.d.). Finding the proper balance of protein is extremely important for overall health. Eating a diet high in protein poses many health risks. The risk factor for heart disease and cancer is increased when a diet contains too much protein. Animal proteins contain a higher fat content which leads to higher cholesterol which plays a large role in heart disease. Research shows that people who consume a high amount of protein tend to have a higher...
Words: 574 - Pages: 3
